Stem-loop sequence aca-mir-199a-2

AccessionMI0018795 (change log)
DescriptionAnolis carolinensis miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   ---------a    -    c   gcc       u        c   ---u   ga 
5'           uccu gcuc guc   ccagugu cagacuac ugu    cag  c
             |||| |||| |||   ||||||| |||||||| |||    |||  a
3'           agga cggg cag   gguuaca gucugaug aca    guc  a
   agcgacgcaa    a    u   auu       c        -   uguu   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
AAWZ02037129.1: 4064-4162 [+]
intergenic
Database links

Mature sequence aca-miR-199a-5p

Accession MIMAT0021834
Sequence

16 - 

cccaguguucagacuaccugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).