Stem-loop sequence aca-mir-199a-1

AccessionMI0018794 (change log)
DescriptionAnolis carolinensis miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   -----ga   -    c c  uc       u        c   ucaggaa   a 
5'        cca gccc g cu  ccagugu cagacuac ugu       gcu c
          ||| |||| | ||  ||||||| |||||||| |||       ||| a
3'        ggu cggg c ga  gguuaca gucugaug aca       ugg a
   acgagug   u    u a  uu       c        -   -----ug   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 80766220-80766316 [-]
sense
ENSACAT00000018392 ; aca-mir-199a-1-201; exon 1
antisense
ENSACAT00000015615 ; DNM2-201; intron 14
Database links

Mature sequence aca-miR-199a-5p

Accession MIMAT0021834
Sequence

16 - 

cccaguguucagacuaccugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).