Stem-loop sequence aca-mir-196c

AccessionMI0018793 (change log)
DescriptionAnolis carolinensis miR-196c stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   ccua      uucu                cac   g   ggaauuca 
5'     gaacug    guggauuagguaguuu   guu uug        u
       ||||||    ||||||||||||||||   ||| |||        u
3'     uuugac    cauuuaguccaucaaa   caa aac        u
   --ua      --cu                aua   g   acacaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 75666539-75666633 [-]
sense
ENSACAT00000020908 ; aca-mir-196c-201; exon 1
Database links

Mature sequence aca-miR-196c-5p

Accession MIMAT0021832
Previous IDsaca-miR-196c
Sequence

21 - 

uagguaguuucacguuguuggg

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-196c-3p

Accession MIMAT0021833
Previous IDsaca-miR-196c*
Sequence

59 - 

acaagaacauaaaacuaccuga

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).