Stem-loop sequence aca-mir-196a-2

AccessionMI0018792 (change log)
DescriptionAnolis carolinensis miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   ---------------   uc       u          a          guugg 
5'                uga  cgugguu agguaguuuc uguuguuggg     c
                  |||  ||||||| |||||||||| ||||||||||      
3'                acu  gcauuaa uccgucaaag acaacggcuc     u
   aacuacuucugauug   --       u          a          aauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 72077166-72077258 [-]
sense
ENSACAT00000019068 ; aca-mir-196a-2-201; exon 1
Database links

Mature sequence aca-miR-196a

Accession MIMAT0021831
Sequence

13 - 

uagguaguuucauguuguugg

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).