Stem-loop sequence aca-mir-194-1

AccessionMI0018789 (change log)
DescriptionAnolis carolinensis miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   aua     u g     u         a      g     uaa 
5'    cagug c ucaag guaacagca cuccau uggaa   g
      ||||| | ||||| ||||||||| |||||| |||||   u
3'    gucau g aguuu cauugucgu gaggug accuu   a
   -ca     c a     u         g      -     uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 243290929-243291013 [-]
sense
ENSACAT00000018891 ; aca-mir-194-1-201; exon 1
antisense
ENSACAT00000001695 ; IARS2-201; intron 11
Clustered miRNAs
< 10kb from aca-mir-194-1
aca-mir-194-1chr1: 243290929-243291013 [-]
aca-mir-215chr1: 243290652-243290747 [-]
Database links

Mature sequence aca-miR-194-5p

Accession MIMAT0021828
Previous IDsaca-miR-194
Sequence

17 - 

uguaacagcaacuccaugugga

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-194-1-3p

Accession MIMAT0021829
Previous IDsaca-miR-194-1*
Sequence

51 - 

ccaguggaggugcuguuacuuu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).