Stem-loop sequence aca-mir-191

AccessionMI0018787 (change log)
DescriptionAnolis carolinensis miR-191 stem-loop
Gene family MIPF0000194; mir-191
Stem-loop
   --  uu  u  ug  c          c  aa       uuuuccu 
5'   gu  ga ag  gg aacggaaucc aa  gcagcug       c
     ||  || ||  || |||||||||| ||  |||||||       u
3'   ca  cu uc  uc uugcuuuagg uu  cgucgac       u
   cc  uc  u  gu  c          -  ca       cuugaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 187865095-187865184 [-]
antisense
ENSACAT00000018315 ; aca-mir-191-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-191
aca-mir-191chr2: 187865095-187865184 [-]
aca-mir-425chr2: 187863021-187863112 [-]
aca-mir-2970chr2: 187861413-187861498 [-]
Database links

Mature sequence aca-miR-191-5p

Accession MIMAT0021824
Previous IDsaca-miR-191
Sequence

14 - 

caacggaaucccaaaagcagcug

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-191-3p

Accession MIMAT0021825
Previous IDsaca-miR-191*
Sequence

56 - 

gcugcacuuggauuucguuccu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).