Stem-loop sequence aca-mir-190b

AccessionMI0018786 (change log)
DescriptionAnolis carolinensis miR-190b stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   ccucc     cuuc     -----              a     --    a 
5'      cccug    ugcug     auauguuugauauu gguug  uucu c
        |||||    |||||     |||||||||||||| |||||  ||||  
3'      gggac    gcgac     uauacaaacuauaa ucaac  aagg u
   --ccc     ---c     auucu              a     ca    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aca-miR-190b

Accession MIMAT0021823
Sequence

18 - 

ugauauguuugauauuagguug

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).