Stem-loop sequence aca-mir-190a

AccessionMI0018785 (change log)
DescriptionAnolis carolinensis miR-190a stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   -----uuuccu  a          u  u             ua     uaau 
5'            gc gggcucugug ga auguuugauauau  gguug    u
              || |||||||||| || |||||||||||||  |||||     
3'            cg cccgggacau cu uacaaacuauaua  ucaac    g
   gaccucugucu  c          c  -             --     ccga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL344433.1: 25387-25484 [+]
sense
ENSACAT00000019496 ; aca-mir-190a-201; exon 1
ENSACAT00000008188 ; TLN2-201; intron 46
Database links

Mature sequence aca-miR-190a-5p

Accession MIMAT0021821
Previous IDsaca-miR-190a
Sequence

20 - 

ugauauguuugauauauuagguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-190a-3p

Accession MIMAT0021822
Previous IDsaca-miR-190a*
Sequence

56 - 

acuauauaucaaacauuccu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).