Stem-loop sequence aca-mir-18b

AccessionMI0018784 (change log)
DescriptionAnolis carolinensis miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   gaaaca             --   u    c   u     ua  --g     
5'       gcuuccugugcua  agg gcau uag gcagu  gu   aagu 
         |||||||||||||  ||| |||| ||| |||||  ||   ||| a
3'       cggaggauacggu  ucc cgua guc cguca  ua   uucg 
   -----c             cu   u    a   c     uc  aga     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL344214.1: 22462-22553 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-18b
aca-mir-106GL344214.1: 22319-22394 [+]
aca-mir-18bGL344214.1: 22462-22553 [+]
aca-mir-20bGL344214.1: 24032-24114 [+]
aca-mir-19cGL344214.1: 24230-24313 [-]
aca-mir-92a-2GL344214.1: 24426-24524 [+]
aca-mir-363GL344214.1: 24588-24686 [+]
Database links

Mature sequence aca-miR-18b-5p

Accession MIMAT0021819
Previous IDsaca-miR-18b
Sequence

18 - 

uaaggugcaucuagugcaguuag

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-18b-3p

Accession MIMAT0021820
Previous IDsaca-miR-18b*
Sequence

58 - 

uacugcccugaaugcuccuucug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).