Stem-loop sequence aca-mir-18a

Accession MI0018783
Description Anolis carolinensis miR-18a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
agug  u         u   --   u   uc   u    a   -  aa u 
    ac gcuuuuugu cua  agg gca  uag gcag uag ug  g a
    || ||||||||| |||  ||| |||  ||| |||| ||| ||  | g
    ug ugaagaaua ggu  ucc cgu  auc cguc auc ac  u a
---g  u         c   cu   u   ga   c    -   u  ga u 
Get sequence
Genome context
Coordinates (AnoCar2.0) Overlapping transcripts
GL343584.1: 108387-108482 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-18a
aca-mir-17 GL343584.1: 108264-108330 [+]
aca-mir-18a GL343584.1: 108387-108482 [+]
aca-mir-19a GL343584.1: 108526-108609 [+]
aca-mir-20a GL343584.1: 108689-108770 [+]
aca-mir-19b GL343584.1: 108832-108901 [+]
aca-mir-92a-1 GL343584.1: 108945-109012 [+]

Mature sequence aca-miR-18a-5p

Accession MIMAT0021817
Previous IDs aca-miR-18a
Sequence

19 - 

uaaggugcaucuagugcagauag

 - 41

Get sequence
Evidence experimental; Solexa [1]

Mature sequence aca-miR-18a-3p

Accession MIMAT0021818
Previous IDs aca-miR-18a*
Sequence

60 - 

acugcccuaagugcuccuucug

 - 81

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).