Stem-loop sequence aca-mir-18a

AccessionMI0018783 (change log)
DescriptionAnolis carolinensis miR-18a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   agug  u         u   --   u   uc   u    a   -  aa u 
5'     ac gcuuuuugu cua  agg gca  uag gcag uag ug  g a
       || ||||||||| |||  ||| |||  ||| |||| ||| ||  | g
3'     ug ugaagaaua ggu  ucc cgu  auc cguc auc ac  u a
   ---g  u         c   cu   u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343584.1: 108387-108482 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-18a
aca-mir-17GL343584.1: 108264-108330 [+]
aca-mir-18aGL343584.1: 108387-108482 [+]
aca-mir-19aGL343584.1: 108526-108609 [+]
aca-mir-20aGL343584.1: 108689-108770 [+]
aca-mir-19bGL343584.1: 108832-108901 [+]
aca-mir-92a-1GL343584.1: 108945-109012 [+]
Database links

Mature sequence aca-miR-18a-5p

Accession MIMAT0021817
Previous IDsaca-miR-18a
Sequence

19 - 

uaaggugcaucuagugcagauag

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-18a-3p

Accession MIMAT0021818
Previous IDsaca-miR-18a*
Sequence

60 - 

acugcccuaagugcuccuucug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).