Stem-loop sequence aca-mir-187

AccessionMI0018782 (change log)
DescriptionAnolis carolinensis miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   --------    aga         a       ga       c -  u 
5'         ugug   ccuuuggcu caacaca  acauggg g cu u
           ||||   ||||||||| |||||||  ||||||| | || c
3'         acac   ggagaccga guugugu  ugugcuc c gg u
   acgguucu    -gg         c       uc       c a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 57644258-57644344 [-]
sense
ENSACAT00000019829 ; aca-mir-187-201; exon 1
Database links

Mature sequence aca-miR-187-5p

Accession MIMAT0021815
Previous IDsaca-miR-187*
Sequence

14 - 

gcuacaacacagaacaugggcg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-187-3p

Accession MIMAT0021816
Previous IDsaca-miR-187
Sequence

49 - 

ucgugucuuguguugcagcca

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).