Stem-loop sequence aca-mir-184

AccessionMI0018781 (change log)
DescriptionAnolis carolinensis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention aca-mir-184
(4 sentences)

Stem-loop
   cu  agc        uc         c      ag     uuucuu 
5'   gg   cgcucacg  cccuuauca uuuucc  ccagc      g
     ||   ||||||||  ||||||||| ||||||  |||||      u
3'   cc   gugggugu  gggaauagu aagagg  gguug      c
   gu  aga        uu         c      ca     ccaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aca-miR-184-5p

Accession MIMAT0021813
Previous IDsaca-miR-184*
Sequence

19 - 

ccuuaucacuuuuccagccagc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-184-3p

Accession MIMAT0021814
Previous IDsaca-miR-184
Sequence

58 - 

uggacggagaacugauaagggu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).