Stem-loop sequence aca-mir-181b-2

AccessionMI0018779 (change log)
DescriptionAnolis carolinensis miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   caaaa       aucaa         cug           aa  a 
5'      ggucaca     cauucauug   ucgguggguuu  cu u
        |||||||     |||||||||   |||||||||||  ||  
3'      ccggugu     guaaguaac   agucacucgaa  gg g
   -cacc       -caac         --a           ca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343211.1: 716891-716978 [-]
sense
ENSACAT00000019090 ; aca-mir-181b-2-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-181b-2
aca-mir-181a-1GL343211.1: 717080-717172 [-]
aca-mir-181b-2GL343211.1: 716891-716978 [-]
Database links

Mature sequence aca-miR-181b

Accession MIMAT0021810
Sequence

16 - 

aacauucauugcugucgguggg

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).