Stem-loop sequence aca-mir-181b-1

AccessionMI0018778 (change log)
DescriptionAnolis carolinensis miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   auaac  -     aucaa         cu     u     uuagg 
5'      gg cugca     cauucauug  gucgg ggguu     u
        || |||||     |||||||||  ||||| |||||      
3'      cc gacgu     guaaguaac  caguc cucga     u
   --aga  a     caaac         --     u     cugac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343937.1: 20214-20300 [-]
antisense
ENSACAT00000006884 ; NR6A1-201; intron 3
Clustered miRNAs
< 10kb from aca-mir-181b-1
aca-mir-181a-2GL343937.1: 21112-21205 [-]
aca-mir-181b-1GL343937.1: 20214-20300 [-]
Database links

Mature sequence aca-miR-181b

Accession MIMAT0021810
Sequence

16 - 

aacauucauugcugucgguggg

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).