Stem-loop sequence aca-mir-181b-1

Accession MI0018778
Description Anolis carolinensis miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
auaac  -     aucaa         cu     u     uuagg 
     gg cugca     cauucauug  gucgg ggguu     u
     || |||||     |||||||||  ||||| |||||      
     cc gacgu     guaaguaac  caguc cucga     u
--aga  a     caaac         --     u     cugac 
Get sequence
Genome context
Coordinates (AnoCar2.0) Overlapping transcripts
GL343937.1: 20214-20300 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-181b-1
aca-mir-181a-2 GL343937.1: 21112-21205 [-]
aca-mir-181b-1 GL343937.1: 20214-20300 [-]

Mature sequence aca-miR-181b

Accession MIMAT0021810
Sequence

16 - 

aacauucauugcugucgguggg

 - 37

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).