Stem-loop sequence aca-mir-181a-3

AccessionMI0018777 (change log)
DescriptionAnolis carolinensis miR-181a-3 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention aca-mir-181a-3
(1 sentences)

Stem-loop
   ---ua       u    aa          cu       a    u u aa 
5'      aaagguc uggg  acauucaacg  gucggug guuu g c  u
        ||||||| ||||  ||||||||||  ||||||| |||| | |   
3'      uuuucgg gucc  ugugaguugu  cagcuac caaa c g  g
   aaaca       c    ca          --       -    - u aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 77116225-77116317 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-181a-3
aca-mir-181a-3chr2: 77116225-77116317 [-]
aca-mir-181cchr2: 77114294-77114378 [-]
Database links

Mature sequence aca-miR-181a

Accession MIMAT0021809
Sequence

16 - 

aacauucaacgcugucggugagu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).