Stem-loop sequence aca-mir-181a-2

AccessionMI0018776 (change log)
DescriptionAnolis carolinensis miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention aca-mir-181a-2
(1 sentences)

Stem-loop
   ---  -     -      u a   u      cu       a     gaau g 
5'    ag gauag cuucag g aca ucaacg  gucggug guuug    c a
      || ||||| |||||| | ||| ||||||  ||||||| |||||    |  
3'    uc cuauu ggaguu c ugu aguugc  cagcuac caaac    g g
   cag  a     u      c a   c      --       -     ---- a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343937.1: 21112-21205 [-]
antisense
ENSACAT00000006884 ; NR6A1-201; intron 3
Clustered miRNAs
< 10kb from aca-mir-181a-2
aca-mir-181a-2GL343937.1: 21112-21205 [-]
aca-mir-181b-1GL343937.1: 20214-20300 [-]
Database links

Mature sequence aca-miR-181a

Accession MIMAT0021809
Sequence

16 - 

aacauucaacgcugucggugagu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).