Stem-loop sequence aca-mir-181a-1

AccessionMI0018775 (change log)
DescriptionAnolis carolinensis miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention aca-mir-181a-1
(1 sentences)

Stem-loop
   --      -   uc  u a   u      cu       a    gggau 
5'   gugguu gcu  ag g aca ucaacg  gucggug guuu     u
     |||||| |||  || | ||| ||||||  ||||||| ||||     a
3'   uaccaa cga  uc c ugu aguugc  cagcuac caaa     a
   cc      u   cc  c a   u      --       -    aguga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343211.1: 717080-717172 [-]
sense
ENSACAT00000020202 ; aca-mir-181a-1-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-181a-1
aca-mir-181a-1GL343211.1: 717080-717172 [-]
aca-mir-181b-2GL343211.1: 716891-716978 [-]
Database links

Mature sequence aca-miR-181a

Accession MIMAT0021809
Sequence

16 - 

aacauucaacgcugucggugagu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).