Stem-loop sequence aca-mir-1805

AccessionMI0018774 (change log)
DescriptionAnolis carolinensis miR-1805 stem-loop
Gene family MIPF0000947; mir-1805
Stem-loop
   g   ca    a           c      -    a cuu  ca 
5'  gaa  uucu ggaguuguagu uuucaa acag g   ug  a
    |||  |||| ||||||||||| |||||| |||| |   ||   
3'  cuu  aagg ccucgacauca aagguu uguc c   ac  g
   -   uc    a           c      a    - -au  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 110979898-110979981 [+]
sense
ENSACAT00000011304 ; GABRG3-201; intron 2
Database links

Mature sequence aca-miR-1805-5p

Accession MIMAT0021807
Sequence

14 - 

aguuguagucuuucaaacagag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1805-3p

Accession MIMAT0021808
Sequence

53 - 

uguauuggaacacuacagcucc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).