Stem-loop sequence aca-mir-1788

AccessionMI0018773 (change log)
DescriptionAnolis carolinensis miR-1788 stem-loop
Gene family MIPF0000792; mir-1788
Stem-loop
   uguaac    ----c    cu           c         c -g  gau 
5'       cucc     ugug  gggcuuguuuu aguugccug g  cu   u
         ||||     ||||  ||||||||||| ||||||||| |  ||    
3'       gagg     acau  ucugaacgaaa ucgacggac c  gg   a
   --ccaa    aaagu    ag           -         u ag  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 87812117-87812212 [-]
intergenic
Database links

Mature sequence aca-miR-1788-5p

Accession MIMAT0021805
Sequence

19 - 

ggcuuguuuucaguugccugcg

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1788-3p

Accession MIMAT0021806
Sequence

58 - 

caggcagcuaaagcaagucug

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).