Stem-loop sequence aca-mir-17

AccessionMI0018772 (change log)
DescriptionAnolis carolinensis miR-17 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
       -ca        a  g     gua  gaua 
5' augu   aagugcuu ca ugcag   gu    a
   ||||   |||||||| || |||||   ||     
3' uacg   uucacgga gu acguc   ca    g
       aug        a  g     auc  agau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343584.1: 108264-108330 [+]
sense
ENSACAT00000019999 ; aca-mir-17-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-17
aca-mir-17GL343584.1: 108264-108330 [+]
aca-mir-18aGL343584.1: 108387-108482 [+]
aca-mir-19aGL343584.1: 108526-108609 [+]
aca-mir-20aGL343584.1: 108689-108770 [+]
aca-mir-19bGL343584.1: 108832-108901 [+]
aca-mir-92a-1GL343584.1: 108945-109012 [+]
Database links

Mature sequence aca-miR-17-5p

Accession MIMAT0021803
Previous IDsaca-miR-17
Sequence

5 - 

caaagugcuuacagugcagguag

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-17-3p

Accession MIMAT0021804
Previous IDsaca-miR-17*
Sequence

43 - 

acugcagugaaggcacuuguag

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).