Stem-loop sequence aca-mir-16b

AccessionMI0018771 (change log)
DescriptionAnolis carolinensis miR-16b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --u   -c     gc cu       cgua          ucua       
5'    guc  gcccg  u  agcagca    aauacuggag    ggauga 
      |||  |||||  |  |||||||    ||||||||||    ||||| u
3'    uag  ugggc  a  ucgucgu    uuaugaccuc    uuuaca 
   uug   uu     ua uu       uucg          -ccg       
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343761.1: 168379-168473 [+]
sense
Clustered miRNAs
< 10kb from aca-mir-16b
aca-mir-15bGL343761.1: 167247-167327 [+]
aca-mir-16bGL343761.1: 168379-168473 [+]
Database links

Mature sequence aca-miR-16b-5p

Accession MIMAT0021801
Previous IDsaca-miR-16b
Sequence

15 - 

uagcagcacguaaauacuggag

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-16b-3p

Accession MIMAT0021802
Previous IDsaca-miR-16b*
Sequence

58 - 

uccaguauugcuuugcugcuuu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).