Stem-loop sequence aca-mir-16a

AccessionMI0018770 (change log)
DescriptionAnolis carolinensis miR-16a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --ua     uc   ccu         ua        u ua  a   a 
5'     cuugu  cgc   agcagcacg  aauauugg g  gu aag u
       |||||  |||   |||||||||  |||||||| |  || ||| a
3'     ggacg  gcg   ucgucgugu  uuauaacc c  ca uuc a
   uuag     gu   aau         ug        - --  a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 13038961-13039052 [-]
sense
ENSACAT00000007191 ; SMC4-201; intron 5
Clustered miRNAs
< 10kb from aca-mir-16a
aca-mir-15achr3: 13039114-13039198 [-]
aca-mir-16achr3: 13038961-13039052 [-]
Database links

Mature sequence aca-miR-16a-5p

Accession MIMAT0021799
Previous IDsaca-miR-16a
Sequence

15 - 

uagcagcacguaaauauugg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-16a-3p

Accession MIMAT0021800
Previous IDsaca-miR-16a*
Sequence

57 - 

ccaauauuguugugcugcuua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).