Stem-loop sequence aca-mir-1677b

AccessionMI0018769 (change log)
DescriptionAnolis carolinensis miR-1677b stem-loop
Gene family MIPF0000849; mir-1677
Stem-loop
   cuu   u     a  a      -  c    a     u     
5'    agg ccuga cc aagccc cu gagg caaug gagu 
      ||| ||||| || |||||| || |||| ||||| ||| c
3'    ucc ggacu gg uucggg ga cuuc guuau cuuu 
   aau   c     a  a      u  -    a     -     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343197.1: 2025968-2026047 [+]
sense
ENSACAT00000017820 ; NTM-201; intron 3
Database links

Mature sequence aca-miR-1677b-5p

Accession MIMAT0021797
Previous IDsaca-miR-1677b*
Sequence

13 - 

accaaagccccucgaggacaau

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1677b-3p

Accession MIMAT0021798
Previous IDsaca-miR-1677b
Sequence

49 - 

ugacuucagugggcuuaggau

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).