Stem-loop sequence aca-mir-1677a

AccessionMI0018768 (change log)
DescriptionAnolis carolinensis miR-1677a stem-loop
Gene family MIPF0000849; mir-1677
Stem-loop
   ugg    a       a    c -         a   a   gau 
5'    uaua aguguua uccu c ccuauugaa uca ugg   g
      |||| ||||||| |||| | ||||||||| ||| |||    
3'    guau ucacagu agga g ggauaacuu agu acc   c
   gua    a       -    u a         c   c   guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 15152936-15153021 [+]
intergenic
Database links

Mature sequence aca-miR-1677a

Accession MIMAT0021796
Sequence

52 - 

ugacuucaauaggaguaggaug

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).