Stem-loop sequence aca-mir-1662

AccessionMI0018767 (change log)
DescriptionAnolis carolinensis miR-1662 stem-loop
Gene family MIPF0000918; mir-1662
Stem-loop
   ---a  g      u       u        a   guaa  u 
5'     cu ugggcu gacauca ccuacuug gau    ug a
       || |||||| ||||||| |||||||| |||    || a
3'     ga acccgg cuguagu ggaugaac cug    ac u
   ggua  -      u       u        c   --aa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 2558244-2558322 [+]
sense
ENSACAT00000006648 ; VIPR1-201; intron 9
Database links

Mature sequence aca-miR-1662-5p

Accession MIMAT0021794
Previous IDsaca-miR-1662
Sequence

10 - 

uugacaucauccuacuugagau

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1662-3p

Accession MIMAT0021795
Previous IDsaca-miR-1662*
Sequence

49 - 

cccaaguagguugaugucugg

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).