Stem-loop sequence aca-mir-15a

AccessionMI0018766 (change log)
DescriptionAnolis carolinensis miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   g         a  cu       c  c             cau 
5'  cuuuaaagu cu  agcagca au augauuuguaugu   a
    ||||||||| ||  ||||||| || |||||||||||||    
3'  gaaauuuua ga  ucgucgu ua uacugaacguaua   g
   -         a  uu       u  u             aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 13039114-13039198 [-]
sense
ENSACAT00000020501 ; aca-mir-15a-201; exon 1
ENSACAT00000007191 ; SMC4-201; intron 5
Clustered miRNAs
< 10kb from aca-mir-15a
aca-mir-15achr3: 13039114-13039198 [-]
aca-mir-16achr3: 13038961-13039052 [-]
Database links

Mature sequence aca-miR-15a-5p

Accession MIMAT0021792
Previous IDsaca-miR-15a
Sequence

15 - 

uagcagcacaucaugauuugu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-15a-3p

Accession MIMAT0021793
Previous IDsaca-miR-15a*
Sequence

53 - 

caagucauuauuugcugcuuu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).