Stem-loop sequence aca-mir-15b

AccessionMI0018765 (change log)
DescriptionAnolis carolinensis miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   ccc          ua     a  ac          gggac 
5'    ggaggugaug  gcagc ca  augguuugua     a
      ||||||||||  ||||| ||  ||||||||||     c
3'    uuuccauuac  cgucg gu  ugccagacau     a
   --u          uc     g  cu          agaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343761.1: 167247-167327 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-15b
aca-mir-15bGL343761.1: 167247-167327 [+]
aca-mir-16bGL343761.1: 168379-168473 [+]
Database links

Mature sequence aca-miR-15b-5p

Accession MIMAT0021790
Previous IDsaca-miR-15b
Sequence

14 - 

uagcagcacaacaugguuugu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-15b-3p

Accession MIMAT0021791
Previous IDsaca-miR-15b*
Sequence

51 - 

cagaccguucugggcugccuca

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).