Stem-loop sequence aca-mir-155

AccessionMI0018764 (change log)
DescriptionAnolis carolinensis miR-155 stem-loop
Gene family MIPF0000157; mir-155
Stem-loop
   ---c       g          u    a        -u   u 
5'     acacguu uuaaugcuaa cgug uagggguu  uua c
       ||||||| |||||||||| |||| ||||||||  |||  
3'     uguguaa aauuacgauu guac auccucag  agu u
   guga       g          -    -        uc   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 148357592-148357671 [-]
intergenic
Database links

Mature sequence aca-miR-155-5p

Accession MIMAT0021788
Previous IDsaca-miR-155
Sequence

10 - 

uuaaugcuaaucgugauagggg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-155-3p

Accession MIMAT0021789
Previous IDsaca-miR-155*
Sequence

49 - 

cuccuacauguuagcauuaag

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).