Stem-loop sequence aca-mir-148b

AccessionMI0018760 (change log)
DescriptionAnolis carolinensis miR-148b stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   aguuaau   -  g       ug         u  a    cu    g g    
5'        gca gc cuugagg  aaguucugu au cacu  gacu u gcu 
          ||| || |||||||  ||||||||| || ||||  |||| | || a
3'        cgu cg gagcucu  uucaagaca ua guga  cuga g ugu 
   -----ac   u  a       gu         c  c    --    a g    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 71202707-71202803 [-]
intergenic
Database links

Mature sequence aca-miR-148b-5p

Accession MIMAT0021782
Previous IDsaca-miR-148b*
Sequence

22 - 

gaaguucuguuauacacucug

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-148b-3p

Accession MIMAT0021783
Previous IDsaca-miR-148b
Sequence

61 - 

ucagugcaucacagaacuuugu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).