Stem-loop sequence aca-mir-148a

AccessionMI0018759 (change log)
DescriptionAnolis carolinensis miR-148a stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   cagauuu         aa             --a    cg    -   au 
5'        ggucucugg  gcaaaguucugug   cacu  gacu cug  u
          |||||||||  |||||||||||||   ||||  |||| |||  a
3'        ccgggggcc  uguuucaagacau   guga  cuga gau  u
   -----ug         gc             cac    --    a   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 31781707-31781799 [-]
sense
ENSACAT00000020521 ; aca-mir-148a-201; exon 1
Database links

Mature sequence aca-miR-148a-5p

Accession MIMAT0021780
Previous IDsaca-miR-148a*
Sequence

21 - 

aaaguucugugacacucggacu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-148a-3p

Accession MIMAT0021781
Previous IDsaca-miR-148a
Sequence

59 - 

ucagugcacuacagaacuuugu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).