Stem-loop sequence aca-mir-146b

AccessionMI0018757 (change log)
DescriptionAnolis carolinensis miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ---  -u       uu        -  uuuc         uuuccau 
5'    gu  ccaagcu  gagaacug gu    guggacugg       u
      ||  |||||||  |||||||| ||    |||||||||        
3'    cg  gguucga  cuuuugac cg    uaccugacu       u
   cca  uc       -c        u  -uaa         cuucuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343301.1: 1588671-1588759 [+]
sense
ENSACAT00000003914 ; DDRGK1-201; intron 8
Database links

Mature sequence aca-miR-146b-5p

Accession MIMAT0021777
Previous IDsaca-miR-146b
Sequence

12 - 

ugagaacugguuuucguggacu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-146b-3p

Accession MIMAT0021778
Previous IDsaca-miR-146b*
Sequence

56 - 

uccauaaugcucaguuuucca

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).