Stem-loop sequence aca-mir-146a

AccessionMI0018756 (change log)
DescriptionAnolis carolinensis miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   -----------       cug          u    -a   --     a 
5'            ccuagcu   agaacugaau ccau  ggc  uuuag a
              |||||||   |||||||||| ||||  |||  ||||| u
3'            ggaucga   ucuugacuua ggug  ccg  aaguu a
   aaaucaacgac       -ca          -    cc   ca     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 39596502-39596586 [+]
sense
ENSACAT00000019361 ; aca-mir-146a-201; exon 1
Database links

Mature sequence aca-miR-146a-5p

Accession MIMAT0021775
Previous IDsaca-miR-146a
Sequence

9 - 

ugagaacugaauuccauaggc

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-146a-3p

Accession MIMAT0021776
Previous IDsaca-miR-146a*
Sequence

47 - 

gccccguggauucaguucuaca

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).