Stem-loop sequence aca-mir-144

AccessionMI0018754 (change log)
DescriptionAnolis carolinensis miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   c   ---gucucu   cc  -        a         a  u gaa 
5'  gaa         ggg  gg auaucauc uauacugua gu g   u
    |||         |||  || |||||||| ||||||||| || |    
3'  cuu         ucc  uc uguaguag auaugacau ca c   g
   u   aaauccacu   -a  a        -         -  - aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aca-miR-144-5p

Accession MIMAT0021771
Previous IDsaca-miR-144*
Sequence

16 - 

ggauaucaucauauacuguaa

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-144-3p

Accession MIMAT0021772
Previous IDsaca-miR-144
Sequence

52 - 

uacaguauagaugauguacu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).