Stem-loop sequence aca-mir-143

AccessionMI0018753 (change log)
DescriptionAnolis carolinensis miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   aug      ag   a  g         g      u  -   g 
5'    ucuccc  ccc ag ugcagugcu caucuc gg uca u
      ||||||  ||| || ||||||||| |||||| || |||  
3'    ggaggg  ggg uc augucacga guagag cu agu u
   caa      aa   c  g         a      u  g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 122658929-122659013 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-143
aca-mir-143chr2: 122658929-122659013 [-]
aca-mir-145chr2: 122657687-122657782 [-]
Database links

Mature sequence aca-miR-143-5p

Accession MIMAT0021769
Previous IDsaca-miR-143*
Sequence

17 - 

ggugcagugcugcaucucugg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-143-3p

Accession MIMAT0021770
Previous IDsaca-miR-143
Sequence

51 - 

ugagaugaagcacuguagcuc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).