Stem-loop sequence aca-mir-142

AccessionMI0018752 (change log)
DescriptionAnolis carolinensis miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   gg      g                 a         -uaaac  c 
5'   acagug acucauccauaaaguag aagcacuac      gc u
     |||||| ||||||||||||||||| |||||||||      ||  
3'   ugucau ugaguagguauuucauc uuugugaug      cg g
   -g      g                 c         ugaacc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343287.1: 1405158-1405247 [-]
intergenic
Database links

Mature sequence aca-miR-142-5p

Accession MIMAT0021767
Sequence

17 - 

cauaaaguagaaagcacuacua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-142-3p

Accession MIMAT0021768
Sequence

55 - 

uguaguguuuccuacuuuaug

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).