Stem-loop sequence aca-mir-137a

AccessionMI0018744 (change log)
DescriptionAnolis carolinensis miR-137a stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   agcuuccug           ug   g           ug a     -  g 
5'          acucucuucgg  acg guauucuuggg  g uaaua cg a
            |||||||||||  ||| |||||||||||  | ||||| || u
3'          ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   ---cgcuca           ga   g           gu -     u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 92342034-92342131 [-]
intergenic
Database links

Mature sequence aca-miR-137a

Accession MIMAT0021754
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).