Stem-loop sequence aca-mir-135-3

AccessionMI0018743 (change log)
DescriptionAnolis carolinensis miR-135-3 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   -aagc      c                 uau          uugcuu 
5'      ccucug uguggucuauggcuuuu   uccuauguga      u
        |||||| |||||||||||||||||   ||||||||||       
3'      ggagac acaucggguaccgaaaa   gggauguacu      u
   aauaa      -                 -uc          caauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343228.1: 62414-62508 [-]
intergenic
Database links

Mature sequence aca-miR-135-5p

Accession MIMAT0021750
Previous IDsaca-miR-135
Sequence

19 - 

uauggcuuuuuauuccuauguga

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-135-3-3p

Accession MIMAT0021753
Previous IDsaca-miR-135-3*
Sequence

58 - 

auguagggcuaaaagccaugg

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).