Stem-loop sequence aca-mir-135-2

Accession MI0018742
Description Anolis carolinensis miR-135-2 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
uaaa     ucua                u            u g a 
    uucac    guguuuuauggcuuuu auuccuauguga a u a
    |||||    |||||||||||||||| |||||||||||| | | u
    aagug    cauaaaguaccgaagg uagggauguacu u a a
-aaa     -uua                -            c g a
Get sequence
Genome context
Coordinates (AnoCar2.0) Overlapping transcripts
5: 29776318-29776411 [-]
sense

Mature sequence aca-miR-135-5p

Accession MIMAT0021750
Previous IDs aca-miR-135
Sequence

20 -  

uauggcuuuuuauuccuauguga

 - 42

Get sequence
Evidence experimental; Solexa [1]

Mature sequence aca-miR-135-2-3p

Accession MIMAT0021752
Previous IDs aca-miR-135-2*
Sequence

58 -  

auguagggauggaagccaugaa

 - 79

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).