Stem-loop sequence aca-mir-135-2

AccessionMI0018742 (change log)
DescriptionAnolis carolinensis miR-135-2 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   uaaa     ucua                u            u g a 
5'     uucac    guguuuuauggcuuuu auuccuauguga a u a
       |||||    |||||||||||||||| |||||||||||| | | u
3'     aagug    cauaaaguaccgaagg uagggauguacu u a a
   -aaa     -uua                -            c g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 29776318-29776411 [-]
sense
ENSACAT00000018094 ; aca-mir-135-2-201; exon 1
Database links

Mature sequence aca-miR-135-5p

Accession MIMAT0021750
Previous IDsaca-miR-135
Sequence

20 - 

uauggcuuuuuauuccuauguga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-135-2-3p

Accession MIMAT0021752
Previous IDsaca-miR-135-2*
Sequence

58 - 

auguagggauggaagccaugaa

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).