Stem-loop sequence aca-mir-135-1

AccessionMI0018741 (change log)
DescriptionAnolis carolinensis miR-135-1 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   aguaug     u   c  c         uu            uuauau 
5'       cccca ugu uu uauggcuuu  auuccuauguga      c
         ||||| ||| || |||||||||  ||||||||||||       
3'       ggggu gca aa guaccgaag  uagggauauacu      a
   --uuua     c   u  u         -u            uuaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 153285340-153285434 [+]
intergenic
Database links

Mature sequence aca-miR-135-5p

Accession MIMAT0021750
Previous IDsaca-miR-135
Sequence

20 - 

uauggcuuuuuauuccuauguga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-135-1-3p

Accession MIMAT0021751
Previous IDsaca-miR-135-1*
Sequence

59 - 

auauagggauugaagccaugua

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).