Stem-loop sequence aca-mir-133a-2

AccessionMI0018740 (change log)
DescriptionAnolis carolinensis miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Literature search

2 open access papers mention aca-mir-133a-2
(8 sentences)

Stem-loop
   cuuaau        uuu    a       aa  u  a        accug 
5'       gucgaugc   gcua agcuggu  aa gg accaaauc     u
         ||||||||   |||| |||||||  || || ||||||||      
3'       uaguuaug   cgau ucgacca  uu cc ugguuuag     u
   -----c        uau    g       ac  c  c        guaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 38863208-38863304 [+]
antisense
ENSACAT00000019356 ; aca-mir-133a-2-201; exon 1
ENSACAT00000007873 ; MIB1-201; intron 12
Clustered miRNAs
< 10kb from aca-mir-133a-2
aca-mir-1a-1chr4: 38859440-38859535 [+]
aca-mir-133a-2chr4: 38863208-38863304 [+]
Database links

Mature sequence aca-miR-133a

Accession MIMAT0021749
Sequence

60 - 

uuugguccccuucaaccagcug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).