Stem-loop sequence aca-mir-133a-1

AccessionMI0018739 (change log)
DescriptionAnolis carolinensis miR-133a-1 stem-loop
Gene family MIPF0000029; mir-133
Literature search

2 open access papers mention aca-mir-133a-1
(8 sentences)

Stem-loop
   gaggcccag     uuu    a       aa  u  a        aacug 
5'          aaugc   gcua agcuggu  aa gg accaaauc     u
            |||||   |||| |||||||  || || ||||||||      
3'          uuacg   cgau ucgacca  uu cc ugguuuag     u
   -----cuag     ugu    g       ac  c  c        guaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 151864278-151864374 [+]
intergenic
Database links

Mature sequence aca-miR-133a

Accession MIMAT0021749
Sequence

60 - 

uuugguccccuucaaccagcug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).