Stem-loop sequence aca-mir-1329

AccessionMI0018738 (change log)
DescriptionAnolis carolinensis miR-1329 stem-loop
Gene family MIPF0000635; mir-1329
Stem-loop
   gcauc   cu       uaca               u  --auuu u 
5'      gga  guagggg    gugaucagguuacga gg      c c
        |||  |||||||    ||||||||||||||| ||      |  
3'      cuu  uaucccu    cacuaguucgaugcu cc      g u
   uuaga   ag       cuac               -  gacaau a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 147380630-147380722 [-]
sense
ENSACAT00000020619 ; aca-mir-1329-201; exon 1
ENSACAT00000012984 ; ATP6V1C2-201; intron 6
Database links

Mature sequence aca-miR-1329-5p

Accession MIMAT0021747
Previous IDsaca-miR-1329
Sequence

18 - 

uacagugaucagguuacgaug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1329-3p

Accession MIMAT0021748
Previous IDsaca-miR-1329*
Sequence

56 - 

ccucguagcuugaucaccaucu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).