Stem-loop sequence aca-mir-132

AccessionMI0018737 (change log)
DescriptionAnolis carolinensis miR-132 stem-loop
Gene family MIPF0000065; mir-132
Stem-loop
   cacg  aa     ucca    -          u             u  gga 
5'     gc  ccguc    gggc aaccguggcu uagauuguuacug gc   c
       ||  |||||    |||| |||||||||| ||||||||||||| ||    
3'     cg  ggcgg    ccug uugguaccga aucugacaauggu ug   g
   --aa  ca     ----    g          c             u  ggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aca-miR-132-5p

Accession MIMAT0021745
Previous IDsaca-miR-132*
Sequence

23 - 

accguggcuuuagauuguua

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-132-3p

Accession MIMAT0021746
Previous IDsaca-miR-132
Sequence

63 - 

uaacagucuacagccaugguug

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).