Stem-loop sequence aca-mir-130c

AccessionMI0018736 (change log)
DescriptionAnolis carolinensis miR-130c stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   --ug      u    a        uc         a   -g  a 
5'     uugcug ccgg gcccuuuu  uguuguacu cug  ca g
       |||||| |||| ||||||||  ||||||||| |||  ||  
3'     gacggu gguu cgggaaaa  auaacguga gau  gu u
   aucg      c    a        uu         c   ga  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343282.1: 1201632-1201718 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-130c
aca-mir-130cGL343282.1: 1201632-1201718 [-]
aca-mir-301bGL343282.1: 1200188-1200281 [-]
Database links

Mature sequence aca-miR-130c

Accession MIMAT0021744
Sequence

52 - 

cagugcaauauuaaaagggcau

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).