Stem-loop sequence aca-mir-130b

AccessionMI0018735 (change log)
DescriptionAnolis carolinensis miR-130b stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   ac      u   cc a       ccc         ----a    cca 
5'   ggggcg cug  c cucuuuc   uguugcacu     cugu   a
     |||||| |||  | |||||||   |||||||||     ||||    
3'   ccucgc gac  g gggaaag   auaacguga     gaca   c
   --      c   -u c       -ua         cgauc    cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343282.1: 1188352-1188439 [-]
sense
ENSACAT00000019450 ; aca-mir-130b-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-130b
aca-mir-454GL343282.1: 1189889-1189992 [-]
aca-mir-130bGL343282.1: 1188352-1188439 [-]
Database links

Mature sequence aca-miR-130b-5p

Accession MIMAT0021742
Previous IDsaca-miR-130b*
Sequence

16 - 

acucuuuccccuguugcacuac

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-130b-3p

Accession MIMAT0021743
Previous IDsaca-miR-130b
Sequence

57 - 

cagugcaauaaugaaagggc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).