Stem-loop sequence aca-mir-130a-1

AccessionMI0018733 (change log)
DescriptionAnolis carolinensis miR-130a-1 stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   ugcau    -  ug     g        c      ug  u  ---   ug 
5'      ggcc cc  uccaa gcucuuuu acauug  cu cu   guc  u
        |||| ||  ||||| |||||||| ||||||  || ||   |||  g
3'      ucgg gg  ggguu cgggaaaa uguaac  ga ga   cag  c
   ---cg    u  gu     a        u      gu  c  acc   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 91616105-91616200 [-]
sense
ENSACAT00000018457 ; aca-mir-130a-1-201; exon 1
Database links

Mature sequence aca-miR-130a-1-5p

Accession MIMAT0021739
Previous IDsaca-miR-130a-1*
Sequence

20 - 

gcucuuuucacauugugcuuc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-130a-3p

Accession MIMAT0021740
Previous IDsaca-miR-130a
Sequence

60 - 

cagugcaauguuaaaagggca

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).