Stem-loop sequence aca-mir-1306

AccessionMI0018732 (change log)
DescriptionAnolis carolinensis miR-1306 stem-loop
Gene family MIPF0000531; mir-1306
Stem-loop
   --    c    u  ccu  a        gug  gc 
5'   ucca cacc cc   gc aacgucca   ac  a
     |||| |||| ||   || ||||||||   ||   
3'   aggu gugg gg   cg uugcaggu   ug  g
   ac    a    u  ucu  g        -aa  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343364.1: 1070716-1070784 [-]
sense
ENSACAT00000008063 ; aca-mir-5417-201; exon 2
Clustered miRNAs
< 10kb from aca-mir-1306
aca-mir-5417GL343364.1: 1077037-1077113 [-]
aca-mir-1306GL343364.1: 1070716-1070784 [-]
Database links

Mature sequence aca-miR-1306

Accession MIMAT0021738
Sequence

42 - 

uggacguuggcucuggugguga

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).