Stem-loop sequence aca-mir-129b

AccessionMI0018731 (change log)
DescriptionAnolis carolinensis miR-129b stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
   ------------cagg    -u        -       c   cu         -------    cu 
5'                 gucu  cccugggu cuuuuug ggu  gggcuuucu       gggu  g
                   ||||  |||||||| ||||||| |||  |||||||||       ||||  u
3'                 cagg  ggggccua gaaaaac cca  cccgaaaga       ccca  c
   agcgccgcuacgggag    uc        c       c   uu         cuaugcc    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 79191950-79192063 [-]
intergenic
Database links

Mature sequence aca-miR-129b-5p

Accession MIMAT0021736
Previous IDsaca-miR-129b
Sequence

18 - 

cuuuuugcggucugggcuuu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-129b-3p

Accession MIMAT0021737
Previous IDsaca-miR-129b*
Sequence

65 - 

aagcccuuaccccaaaaagca

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).