Stem-loop sequence aca-mir-129a

AccessionMI0018730 (change log)
DescriptionAnolis carolinensis miR-129a stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
   uuucuc  u     -       c   cu      g   -  c  cc 
5'       uc cggau cuuuuug ggu  gggcuu cug uu cu  a
         || ||||| ||||||| |||  |||||| ||| || ||   
3'       ag guuua gaaaaac cca  cccgaa gac ga ga  g
   ------  c     u       c   uu      g   u  c  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343800.1: 76641-76726 [-]
sense
ENSACAT00000018091 ; aca-mir-129a-201; exon 1
Database links

Mature sequence aca-miR-129a-5p

Accession MIMAT0021734
Previous IDsaca-miR-129a
Sequence

15 - 

cuuuuugcggucugggcuugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-129a-3p

Accession MIMAT0021735
Previous IDsaca-miR-129a*
Sequence

57 - 

ggaagcccuuaccccaaaaagua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).