Stem-loop sequence aca-mir-125b-2

AccessionMI0018726 (change log)
DescriptionAnolis carolinensis miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention aca-mir-125b-2
(1 sentences)

Stem-loop
   ---caga   uu     uc  ug   c   a        -g   uu 
5'        cuu  ccuag  cc  aga ccu acuuguga  guu  u
          |||  |||||  ||  ||| ||| ||||||||  |||   
3'        gag  ggauc  gg  ucu gga ugaacacu  caa  a
   ccaaggg   gc     ca  gu   c   c        aa   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 153990128-153990217 [-]
antisense
ENSACAT00000020740 ; aca-mir-125b-2-201; exon 1
Database links

Mature sequence aca-miR-125b

Accession MIMAT0021729
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).